ID: 1061591716_1061591722

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1061591716 1061591722
Species Human (GRCh38) Human (GRCh38)
Location 9:131602211-131602233 9:131602235-131602257
Sequence CCCAGCATTCCTGCCTGCAAGTG CTGTGGAGTGCAAGTTCCTATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 19, 4: 214} {0: 1, 1: 0, 2: 0, 3: 7, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!