ID: 1061680916_1061680928

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1061680916 1061680928
Species Human (GRCh38) Human (GRCh38)
Location 9:132242095-132242117 9:132242123-132242145
Sequence CCCGCCTGGGCCGCTGAGCCCCG AGGACGCTCCCCGCACCCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 43, 4: 469} {0: 1, 1: 0, 2: 0, 3: 3, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!