ID: 1061712615_1061712623

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1061712615 1061712623
Species Human (GRCh38) Human (GRCh38)
Location 9:132498491-132498513 9:132498524-132498546
Sequence CCCGCTTCTGCTGTGTGACCCTG AGCCTGCGCTCCTCCCAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 18, 3: 57, 4: 534} {0: 1, 1: 0, 2: 1, 3: 23, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!