ID: 1061825416_1061825420

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1061825416 1061825420
Species Human (GRCh38) Human (GRCh38)
Location 9:133255680-133255702 9:133255708-133255730
Sequence CCGCCTGGTGGTTCTTGGGCACC GAACCTCAGCTTCCTCAGGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 184} {0: 1, 1: 0, 2: 1, 3: 25, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!