ID: 1061869988_1061870001

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1061869988 1061870001
Species Human (GRCh38) Human (GRCh38)
Location 9:133515399-133515421 9:133515444-133515466
Sequence CCCAGCGTGGGCACAGCCCTGGT CCGAGTGGGCTCTGGGGCACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 30, 4: 229} {0: 1, 1: 0, 2: 2, 3: 25, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!