ID: 1061961783_1061961794

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1061961783 1061961794
Species Human (GRCh38) Human (GRCh38)
Location 9:133992398-133992420 9:133992432-133992454
Sequence CCAGGTCCCCCGCTGCGCCGCCG CTCTTCCTCCTCCTACTCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 267} {0: 1, 1: 2, 2: 40, 3: 221, 4: 1120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!