ID: 1061969511_1061969515

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1061969511 1061969515
Species Human (GRCh38) Human (GRCh38)
Location 9:134036310-134036332 9:134036356-134036378
Sequence CCTTTCTTCAGCTGTCTGGGGCA AGTCTCCGTCTACCTGCCGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 209} {0: 1, 1: 0, 2: 0, 3: 4, 4: 36}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!