ID: 1062049998_1062050008 |
View in Genome Browser |
Spacer: 12 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1062049998 | 1062050008 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 9:134442349-134442371 | 9:134442384-134442406 |
Sequence | CCTTGGGGTGAGAGTGAGCCCTC | CCAGAGCGCAGGGACAAAAGGGG |
Strand | - | + |
Off-target summary | {0: 1, 1: 0, 2: 0, 3: 13, 4: 221} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |