ID: 1062117621_1062117633

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1062117621 1062117633
Species Human (GRCh38) Human (GRCh38)
Location 9:134817872-134817894 9:134817910-134817932
Sequence CCCCAGGGGAGCCCAGAGGGTGG GTGGGCAGAGATGTCCATGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 391} {0: 1, 1: 0, 2: 2, 3: 21, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!