ID: 1062189514_1062189518

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1062189514 1062189518
Species Human (GRCh38) Human (GRCh38)
Location 9:135240632-135240654 9:135240648-135240670
Sequence CCCAATGTCCGACTATTCCCAAG TCCCAAGGCCTTCATCCTCATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!