ID: 1062238044_1062238052

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1062238044 1062238052
Species Human (GRCh38) Human (GRCh38)
Location 9:135521985-135522007 9:135522032-135522054
Sequence CCAGGGAAGGGGGAGGCTCTGGA AGGGGCCTTCTCCAGGTGTCAGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 10, 3: 59, 4: 504} {0: 2, 1: 0, 2: 2, 3: 27, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!