ID: 1062248721_1062248730

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1062248721 1062248730
Species Human (GRCh38) Human (GRCh38)
Location 9:135583738-135583760 9:135583781-135583803
Sequence CCGGCCGTGCACACAATGAACCT GATGTCACGGGGCCTGTGGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 53} {0: 1, 1: 0, 2: 0, 3: 10, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!