ID: 1062249315_1062249325

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1062249315 1062249325
Species Human (GRCh38) Human (GRCh38)
Location 9:135586333-135586355 9:135586368-135586390
Sequence CCTGCCCTGGAGCCTCCGGGAGG GGACACCTTGGCTGTAGCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 62, 4: 467} {0: 1, 1: 0, 2: 0, 3: 22, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!