ID: 1062268485_1062268490

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1062268485 1062268490
Species Human (GRCh38) Human (GRCh38)
Location 9:135698286-135698308 9:135698326-135698348
Sequence CCGTGATGCCGGAGGACTGACGG CACAGCGTGCTGCTCCTGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 38} {0: 1, 1: 0, 2: 0, 3: 14, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!