ID: 1062319533_1062319549

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1062319533 1062319549
Species Human (GRCh38) Human (GRCh38)
Location 9:135984075-135984097 9:135984113-135984135
Sequence CCCTCCCCCTGCACCCCTGCTCA CCTGTCCTCAGAGGAGGACAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 106, 4: 1038} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!