ID: 1062335142_1062335154

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1062335142 1062335154
Species Human (GRCh38) Human (GRCh38)
Location 9:136061639-136061661 9:136061681-136061703
Sequence CCAGCCTCAGCCCTCACACGGCC GTCAGAAAGAGGCAGATCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 515} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!