ID: 1062341216_1062341238

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1062341216 1062341238
Species Human (GRCh38) Human (GRCh38)
Location 9:136094768-136094790 9:136094811-136094833
Sequence CCTGCCCCGGCTTCCCCACCCGG GGTCCCTGGGGAGGCCGCGCGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!