ID: 1062397592_1062397606

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1062397592 1062397606
Species Human (GRCh38) Human (GRCh38)
Location 9:136358682-136358704 9:136358720-136358742
Sequence CCACCCCTCCAGCTTCGTCCTGG AAGCCTGTCTCCCCACTCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 361} {0: 1, 1: 0, 2: 6, 3: 39, 4: 319}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!