ID: 1062415651_1062415656

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1062415651 1062415656
Species Human (GRCh38) Human (GRCh38)
Location 9:136448288-136448310 9:136448317-136448339
Sequence CCAGGAGAATGGAGGTGGGAGCA CAGAGACACCAGGAGGATGGAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 3, 3: 41, 4: 361} {0: 11, 1: 4, 2: 6, 3: 49, 4: 443}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!