ID: 1062419716_1062419720

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1062419716 1062419720
Species Human (GRCh38) Human (GRCh38)
Location 9:136474344-136474366 9:136474373-136474395
Sequence CCCTGTGCGGGCAGACTTTCTGG CAGCTCCGAAAACATGGCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 90} {0: 1, 1: 0, 2: 0, 3: 13, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!