ID: 1062419718_1062419720

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1062419718 1062419720
Species Human (GRCh38) Human (GRCh38)
Location 9:136474345-136474367 9:136474373-136474395
Sequence CCTGTGCGGGCAGACTTTCTGGA CAGCTCCGAAAACATGGCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 77} {0: 1, 1: 0, 2: 0, 3: 13, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!