ID: 1062474097_1062474113

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1062474097 1062474113
Species Human (GRCh38) Human (GRCh38)
Location 9:136719071-136719093 9:136719113-136719135
Sequence CCCGATCAGATGCACCCCTGGAG GGTGGAGGGGCCGGACCTCCGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!