ID: 1062494881_1062494896

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1062494881 1062494896
Species Human (GRCh38) Human (GRCh38)
Location 9:136827000-136827022 9:136827041-136827063
Sequence CCTTCCTGGTGGCCTGCTGTGCC CTGTGGGTGCAGAGGCCGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 27, 4: 337} {0: 1, 1: 0, 2: 3, 3: 52, 4: 408}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!