ID: 1062520234_1062520250

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1062520234 1062520250
Species Human (GRCh38) Human (GRCh38)
Location 9:136954614-136954636 9:136954647-136954669
Sequence CCCACCCCAGGTCCCCTGTCCCG TCCCTCTGGGTCCCCTGTCCTGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 6, 3: 42, 4: 421} {0: 1, 1: 0, 2: 1, 3: 39, 4: 452}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!