ID: 1062520246_1062520250

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1062520246 1062520250
Species Human (GRCh38) Human (GRCh38)
Location 9:136954634-136954656 9:136954647-136954669
Sequence CCGGGCCATCTCCTCCCTCTGGG TCCCTCTGGGTCCCCTGTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 56, 4: 666} {0: 1, 1: 0, 2: 1, 3: 39, 4: 452}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!