ID: 1062545966_1062545976

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1062545966 1062545976
Species Human (GRCh38) Human (GRCh38)
Location 9:137063887-137063909 9:137063920-137063942
Sequence CCTGGGAGCTGTCTGGGGGCCCT CAGGCTCACAGGATGTTGTGTGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 7, 3: 72, 4: 603} {0: 1, 1: 0, 2: 4, 3: 29, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!