ID: 1062561053_1062561059

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1062561053 1062561059
Species Human (GRCh38) Human (GRCh38)
Location 9:137142069-137142091 9:137142092-137142114
Sequence CCCTGTCTCCTACACAGCCGGCT TCTACCGCATACCCGTGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 24, 4: 207} {0: 1, 1: 0, 2: 0, 3: 2, 4: 30}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!