ID: 1062564521_1062564534

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1062564521 1062564534
Species Human (GRCh38) Human (GRCh38)
Location 9:137158252-137158274 9:137158295-137158317
Sequence CCGGCAGGAGAAGGAGCAGGGAG AGGGAGAAGCAGCAGGGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 92, 4: 725} {0: 1, 1: 1, 2: 7, 3: 173, 4: 1480}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!