ID: 1062598006_1062598008

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1062598006 1062598008
Species Human (GRCh38) Human (GRCh38)
Location 9:137307713-137307735 9:137307730-137307752
Sequence CCATGACGCAGCCATGCGGCTGA GGCTGAGCACAGTCACCTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 63} {0: 1, 1: 0, 2: 0, 3: 15, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!