ID: 1062623512_1062623518

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1062623512 1062623518
Species Human (GRCh38) Human (GRCh38)
Location 9:137433136-137433158 9:137433149-137433171
Sequence CCGGCTGCCCTCCACCCACAGGG ACCCACAGGGCCCACTTTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 69, 4: 552} {0: 1, 1: 0, 2: 0, 3: 12, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!