ID: 1062631970_1062631980

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1062631970 1062631980
Species Human (GRCh38) Human (GRCh38)
Location 9:137467126-137467148 9:137467171-137467193
Sequence CCAACCTGCATCTGTGCCTTCTC AGCTGCACTGGGAGGCTTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 58, 4: 399} {0: 1, 1: 0, 2: 0, 3: 16, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!