ID: 1062634736_1062634746

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1062634736 1062634746
Species Human (GRCh38) Human (GRCh38)
Location 9:137484861-137484883 9:137484891-137484913
Sequence CCGCCTCCCCAGTCCTGAGGCTG CTCCCGCCTCCCCAGTCCTGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 9, 3: 78, 4: 570} {0: 2, 1: 1, 2: 3, 3: 74, 4: 828}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!