ID: 1062725976_1062725985

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1062725976 1062725985
Species Human (GRCh38) Human (GRCh38)
Location 9:138073804-138073826 9:138073846-138073868
Sequence CCCTGAGGTGGGTTTCATGACTC CTGGGGCATCACTTGGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 255} {0: 1, 1: 0, 2: 7, 3: 75, 4: 741}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!