ID: 1063009994_1063010000

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1063009994 1063010000
Species Human (GRCh38) Human (GRCh38)
Location 10:2012360-2012382 10:2012377-2012399
Sequence CCTGCTGTTCCTGCCTGCAGGGA CAGGGAATGGAGGGTGTTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 37, 4: 413} {0: 1, 1: 0, 2: 1, 3: 36, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!