ID: 1063117546_1063117556

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1063117546 1063117556
Species Human (GRCh38) Human (GRCh38)
Location 10:3082523-3082545 10:3082553-3082575
Sequence CCGGCGCTCGCTCACCCCTGCCT GCTGAGCACAGCCGAAGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 301} {0: 1, 1: 0, 2: 0, 3: 16, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!