ID: 1063313333_1063313339

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1063313333 1063313339
Species Human (GRCh38) Human (GRCh38)
Location 10:4977722-4977744 10:4977765-4977787
Sequence CCATTTTCTGATGAATATTAACA CTGCCAGAAGGCCCTGCGTGTGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 5, 3: 48, 4: 432} {0: 2, 1: 0, 2: 1, 3: 22, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!