ID: 1063314614_1063314622

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1063314614 1063314622
Species Human (GRCh38) Human (GRCh38)
Location 10:4989951-4989973 10:4990004-4990026
Sequence CCACACGCAGGGCCTTCTGGCAG CATCAGAAAATGGATAATTAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 22, 4: 277} {0: 2, 1: 0, 2: 3, 3: 41, 4: 402}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!