ID: 1063447697_1063447703

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1063447697 1063447703
Species Human (GRCh38) Human (GRCh38)
Location 10:6130027-6130049 10:6130044-6130066
Sequence CCCTCCTCCTCCTCTGCACACAG ACACAGGAAACCTCATTCTGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!