ID: 1063856234_1063856242

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1063856234 1063856242
Species Human (GRCh38) Human (GRCh38)
Location 10:10257324-10257346 10:10257369-10257391
Sequence CCCTCCTCCTGCTGCACAGACAG TCCTTTTCTGTTCAACAGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 61, 4: 580} {0: 1, 1: 0, 2: 2, 3: 17, 4: 256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!