ID: 1064064077_1064064081

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1064064077 1064064081
Species Human (GRCh38) Human (GRCh38)
Location 10:12165788-12165810 10:12165817-12165839
Sequence CCAAATAATCGCAGGGCAAGGCA GGCAGGCAGGATAGTGACAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 81} {0: 1, 1: 0, 2: 1, 3: 33, 4: 322}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!