ID: 1064873320_1064873324

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1064873320 1064873324
Species Human (GRCh38) Human (GRCh38)
Location 10:19964263-19964285 10:19964291-19964313
Sequence CCTTAGAGGCTTACAACTTTATC TCGGTTGGTTGGTTTTCAACTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!