ID: 1065782570_1065782584

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1065782570 1065782584
Species Human (GRCh38) Human (GRCh38)
Location 10:29183704-29183726 10:29183752-29183774
Sequence CCTCCCCATCTTCCTCACTCCCT GGGAAGAAAGGGAGAAATCCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!