ID: 1065888167_1065888174

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1065888167 1065888174
Species Human (GRCh38) Human (GRCh38)
Location 10:30097307-30097329 10:30097331-30097353
Sequence CCCTGCAGCCTGGGGTATTAGTG GACAAAGGAGGAAATGTCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 147} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!