ID: 1065926022_1065926027

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1065926022 1065926027
Species Human (GRCh38) Human (GRCh38)
Location 10:30434318-30434340 10:30434334-30434356
Sequence CCGAACCTTCGGGGGGCCGCGGC CCGCGGCTGGAGCGCTCGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 487} {0: 1, 1: 0, 2: 0, 3: 17, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!