ID: 1066220735_1066220748

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1066220735 1066220748
Species Human (GRCh38) Human (GRCh38)
Location 10:33335044-33335066 10:33335085-33335107
Sequence CCCGTCCGTCTGTCTGTCTTTCC CTCCGCGGGAAGGAAGGCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 41, 3: 188, 4: 830} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!