ID: 1067066419_1067066428

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1067066419 1067066428
Species Human (GRCh38) Human (GRCh38)
Location 10:43106495-43106517 10:43106531-43106553
Sequence CCGGGTGGAACACTGGCCCAACG GGCCAACGGCAGCTTCGTGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 64} {0: 1, 1: 0, 2: 2, 3: 4, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!