ID: 1067440578_1067440582

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1067440578 1067440582
Species Human (GRCh38) Human (GRCh38)
Location 10:46307174-46307196 10:46307198-46307220
Sequence CCAGGATGGTGACACCAAGCAGC GTCCCTGGTCATTTAGGACGCGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 0, 3: 6, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!