ID: 1067567282_1067567292

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1067567282 1067567292
Species Human (GRCh38) Human (GRCh38)
Location 10:47348547-47348569 10:47348589-47348611
Sequence CCTGTTCCAGCCAAGCCTGGTGC CTTGGATAACTACTGCTTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 257} {0: 1, 1: 0, 2: 0, 3: 14, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!