ID: 1067567730_1067567734

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1067567730 1067567734
Species Human (GRCh38) Human (GRCh38)
Location 10:47350503-47350525 10:47350539-47350561
Sequence CCGCACAGCTGTGGACTTGGAGT GCTCACAGCAGACCTCCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 158} {0: 1, 1: 0, 2: 2, 3: 43, 4: 345}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!