ID: 1067634395_1067634402

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1067634395 1067634402
Species Human (GRCh38) Human (GRCh38)
Location 10:47991652-47991674 10:47991674-47991696
Sequence CCCAAATCTCCTGCCAGCTCCCA ACTTACCCAGGCTTTCCACCAGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 0, 3: 8, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!